| Description | tRNA Val (CAC) cove=66.64 |
|---|---|
| Locus type | tRNA |
| Locus tag | YALI0E26103r |
| Species | Yarrowia lipolytica | Positions | 3101270..3101342 |
|---|---|---|---|
| Strain | CLIB 122 | Strand | Antisense |
| Chromosome | YALI0E | Total length | 73 (nuc.) |
| Previous locus | YALI0E26081g | Next locus | YALI0E26125g |
Here is a representation of the structure of the locus YALI0E26103r oriented from its 5' end (left) to its 3' end (right). In accordance with the decomposition of feature levels, this locus consists of :
By clicking on the different fragments, you can show/hide the nucleotide sequence that corresponds to the selected region/feature.
>YALI0E26103r
GGTCGTGTGGTGTAATGGTTATCACGTCCCGCTCACACCGGGGAGGCTCGGAGTTCGATC
CTCCGCATGATCA
Locus sequence
Up/downstream sequence
Browse the locus neighborhood with JBrowse:
ATG