| Description | weakly similar to uniprot|P45978 Saccharomyces cerevisiae YPR129w SCD6 suppressor of clathrin deficiency; Pol II C/D snoRNA monocistronic snR52-B |
|---|---|
| Locus type | CDS |
| Locus tag | YALI0D13840r |
| Species | Yarrowia lipolytica | Positions | 1714748..1714836 |
|---|---|---|---|
| Strain | CLIB 122 | Strand | Antisense |
| Chromosome | YALI0D | Total length | 89 (nuc.) |
| Previous locus | YALI0D13794g | Next locus | YALI0D13860g |
Here is a representation of the structure of the locus YALI0D13840r oriented from its 5' end (left) to its 3' end (right). In accordance with the decomposition of feature levels, this locus consists of :
By clicking on the different fragments, you can show/hide the nucleotide sequence that corresponds to the selected region/feature.
>YALI0D13840r
ACCACAATGATGAAGCATTAGGATGTAAATTATTTCACCCGAGAGCGCAAAAAACCGTGC
GGATATTTCCTGCCTTCCTTCTGATTTTG
Locus sequence
Up/downstream sequence
Protein length: 293 aa.
Product: Conserved hypothetical protein
Browse the locus neighborhood with JBrowse:
ATG