| Description | uniprot|Q12724 Yarrowia lipolytica YALI0E26741g ura3-302 Deleted version of uniprot|Q12724 Yarrowia lipolytica Orotidine 5-phosphate decarboxylase |
|---|---|
| Locus type | CDS |
| Gene name | ura3-302 |
| Locus tag | YALI0E26741g |
| Pseudogene | This locus may contain pseudogene(s) |
| Species | Yarrowia lipolytica | Positions | 3175127..3175283 |
|---|---|---|---|
| Strain | CLIB 122 | Strand | Sense |
| Chromosome | YALI0E | Total length | 157 (nuc.) |
| Previous locus | YALI0E26719g | Next locus | YALI0E26763g |
Here is a representation of the structure of the locus YALI0E26741g oriented from its 5' end (left) to its 3' end (right). In accordance with the decomposition of feature levels, this locus consists of :
By clicking on the different fragments, you can show/hide the nucleotide sequence that corresponds to the selected region/feature.
>YALI0E26741g
ACTGTCATCATAATTGTCGGCCGAGGTCTGTACGGCCAGAACCGAGATCCTATTGAGGAG
GCCAAGCGATACCAGAAGGCTGGCTGGGAGGCTTACCAGAAGATTAACTGTTAGAGGTTA
GACTATGGATATGTAATTTAACTGTGTATATAGAGAG
Locus sequence
Up/downstream sequence
Protein length: 38 aa.
Product: Deleted version of uniprot|Q12724 Yarrowia lipolytica Orotidine 5-phosphate decarboxylase
Gene: ura3-302
Browse the locus neighborhood with JBrowse:
ATG